Review



pcr condition  (Jackson Laboratory)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Jackson Laboratory pcr condition
    Pcr Condition, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/condition+pcr/pm41760646-264-28-31
    Average 86 stars, based on 1 article reviews
    pcr condition - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    other:

    Article Title: Lethal eosinophilic crystalline pneumonia in mice expressing a stabilized Csf2 mRNA
    Article Snippet: PCR conditions were as described by The Jackson Laboratory for the Meox2-cre mice.

    Article Title: Treatment and diagnosis of melanoma
    Article Snippet: Mouse Genotyping All mouse genotyping was performed using standard PCR conditions, as recommended by Jackson Labs.

    Article Title: Activin A secreted by human mesenchymal stem cells induces neuronal development and neurite outgrowth in an in vitro model of Alzheimer's disease: neurogenesis induced by MSCs via activin A.
    Article Snippet: Alzheimer’s disease (AD) is characterized by progressive loss of memory in addition to cortical atrophy.. Cortical atrophy in AD brains begins in the parietal and temporal lobes, which are near the subventricular zone (SVZ).. The aim of this study was to activate the neurogenesis in the SVZ of AD brains by human mesenchymal stem cells (hMSCs).

    Article Title: Mediation of transitional B cell maturation in the absence of functional Bruton’s tyrosine kinase
    Article Snippet: Genotyping of tcrb , cd 40 and h2aa (H-2Aalpha) alleles was done on genomic DNA by using primers and PCR conditions described by the Jackson Laboratory (Bar Harbor, ME), and for the Xid mutation by using PCR primers and conditions as described previously .

    Article Title: PTEN negatively regulates the cell lineage progression from NG2+ glial progenitor to oligodendrocyte via mTOR-independent signaling
    Article Snippet: Genotyping was performed using the PCR conditions recommended by The Jackson Laboratories.

    Article Title: Targeted deletion of the aryl hydrocarbon receptor in dendritic cells prevents thymic atrophy in response to dioxin
    Article Snippet: Mice of the correct genotype were identified according to PCR conditions furnished by the Jackson Laboratory, and littermates were used as controls.

    Article Title: A common mechanism of singular gene choice is revealed by broadly expressed odorant receptor transgenes within the olfactory epithelium.
    Article Snippet: PCR conditions for genotyping are published in references and at the Jackson Laboratory.

    Article Title: Probing the pathogenesis of Duchenne muscular dystrophy using mouse models
    Article Snippet: Our description for mdx -specific PCR conditions can be found in the Reagents section and a similar protocol can also be found on the Jackson Laboratories website (jaxmice.jax.org/strain/001801.html).



    Similar Products

    thermal pcr conditions  (Bio-Rad)
    99
    Bio-Rad thermal pcr conditions
    Thermal Pcr Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/T100+Thermal+Cycler/10__4308_slash_hjb__33__4__1147___1156-88-5-11
    Average 99 stars, based on 1 article reviews
    thermal pcr conditions - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    pcr condition  (Jackson Laboratory)
    86
    Jackson Laboratory pcr condition
    Pcr Condition, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/condition+pcr/pm41760646-264-28-31
    Average 86 stars, based on 1 article reviews
    pcr condition - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    pcr conditions  (New England Biolabs)
    99
    New England Biolabs pcr conditions
    Pcr Conditions, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/Q5+High-Fidelity+DNA+Polymerase/pmc12733218-95-26-23
    Average 99 stars, based on 1 article reviews
    pcr conditions - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    standard oligo pool pcr condition  (Twist Bioscience)
    86
    Twist Bioscience standard oligo pool pcr condition
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Standard Oligo Pool Pcr Condition, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/oligo+pool/pmc12526118-76-2-12
    Average 86 stars, based on 1 article reviews
    standard oligo pool pcr condition - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    pcr conditions  (Bio-Rad)
    99
    Bio-Rad pcr conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/T100+Thermal+Cycler/10__31965_slash_infokes__vol23__iss3__1889-72-1-4
    Average 99 stars, based on 1 article reviews
    pcr conditions - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    pcr thermal cycling conditions  (Bio-Rad)
    99
    Bio-Rad pcr thermal cycling conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Thermal Cycling Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/T100+Thermal+Cycler/pm41009624-263-1-8
    Average 99 stars, based on 1 article reviews
    pcr thermal cycling conditions - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc  (Jackson Laboratory)
    86
    Jackson Laboratory paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Paper N A Kras G12d Conditional Pcr Primer 1 Gtctttccccagcacagtgc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/g12d+kras+lsl/pm40712568-356-209-218
    Average 86 stars, based on 1 article reviews
    paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    pcr conditions  (Eppendorf AG)
    97
    Eppendorf AG pcr conditions
    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR <t>oligo</t> pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).
    Pcr Conditions, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+conditions/Mastercycler+nexus/pm40669350-104-14-16
    Average 97 stars, based on 1 article reviews
    pcr conditions - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier

    Image Search Results


    Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR oligo pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).

    Journal: Nucleic Acids Research

    Article Title: A versatile platform for combinatorial antibody library cloning and NGS-based quality control with high accuracy

    doi: 10.1093/nar/gkaf1001

    Figure Lengend Snippet: Scheme of the protocol for 3-CDR VHH phage library cloning and the Mix5 3-CDR VHH artificial library cloning validation. ( A ) Format of 3-CDR oligo pool. ( B ) Format of the FR fragment, FR vector, and receiving vector (V0). ( C ) Scheme of cloning option 1, accurate combinatorial library cloning method. ( D ) Scheme of cloning option 2, full recombination library cloning method. ( E ) Sanger sequencing mapping of the Mix5 designed CDR sequences of the colonies from the full recombination cloning method (left) and accurate combination cloning method (right).

    Article Snippet: Additionally, a standard oligo pool PCR condition was included for comparison, following Twist Bioscience’s oligo pool PCR protocol (10 ng of oligo pool in a 25 μl PCR reaction, 10 cycles).

    Techniques: Cloning, Biomarker Discovery, Plasmid Preparation, Sequencing